CULTIVABLE BACTERIA FROM THE ECTOCARPUS SURFACE – APPLICATIONS

Get Complete Project Material File(s) Now! »

Antibiotic-treatments of algal tissue and growth media

Antibiotics were used to reduce the abundance of dominant bacterial strains from the algal tissue and/or growth media, in our case especially Halomonas sp., and to facilitate the growth of other less abundant or slower-growing bacteria. Algal growth media and/or ground algal tissue was spread on R2A agar plates and incubated with two antibiotic discs (AbD1 and AbD2; Antimicrobial Susceptibility Disks, Bio-Rad Laboratories, Inc, France) for five days at RT, using antibiotics that were shown to be effective against Ectocarpus-derived Halomonas. Alternatively, algal subcultures of the same strain were treated with liquid antibiotics (AbL) for 3 days before plating on R2A or Zobell, whereafter 50 μl were plated on solidified R2A or Zobell. An overview of the antibiotics (discs and liquid) and their concentration can be found in Supplementary table 1-2. Plates were incubated (3-20d) until single colonies were visible and the latter identified with 16S rRNA amplicon sequencing as described below. Two experiments using antibiotic-treated algal tissue (AbD2 with chloramphenicol and erythromycin) were repeated after one year.

Bacterial identification by 16S rRNA gene sequencing

To identify bacterial isolates, single colonies were grown in the corresponding liquid growth media until maximal density was reached. Approximately 50-100 μl of cultures were heated for 15 minutes at 95 °C. Then the 16S rRNA gene was amplified using universal primers (8F 5’ AGAGTTTGATCCTGGCTCAG and 1492R 5’ GGTTACCTTGTTACGACTT from  Weisenburg et al. (1991) and the GoTaq polymerase in a PCR reaction with the following amplification conditions: 2 min. 95 °C; [1 min 95 °C; 30 sec. 53 °C; 3 min 72 °C] 30 cycles; 5 min 72 °C. In some cases, a commercial kit was used to extract DNA (NucleoSpin® Tissue, Machery-Nagel; support protocol for bacteria). The PCR products were purified using ExoSAP (Affymetrix Inc, Thermo Fisher Scientific) and sequenced with Sanger technology (BigDye Xterminator v3.1 cycle sequencing kit, Applied Biosystems®, Thermo Fisher Scientific). Only the forward primer 8F was used for the sequencing reaction. For classification and analyses of the  sequences, RDP classifier (Wang et al., 2007) and BLAST1 against the NCBI nr and 16S rRNA gene databases were used and sequences classified at the genus level if possible. Sequences were aligned and checked manually to verify mismatches and to identify distinct strains within a genus (>99% identity). The 16S rRNA gene sequences from each distinct cultivable strain were aligned using MAFFT2 version 7 (Katoh et al., 2002) and the G-INS-i algorithm. Only well-aligned positions with less than 5% alignment gaps (492 positions) were retained. Phylogenetic trees were reconstructed using the Maximum-Likelihood method implemented in MEGA6.06 (Tamura et al., 2013), and the GTR+G+I model. Five hundred bootstrap replicates were tested to assess the robustness of the tree. The unique 16S rRNA gene sequences were submitted to the European Molecular Biology Laboratory (EMBL) database and are available under project accession number PRJEB22665. Stocks of bacterial isolates were preserved in 40% glycerol at -80°C. The numbers of sequences obtained per taxa were normalized against the total number of sequences obtained within the complete cultivation study. To assess cultivation biases statistically, the absolute abundances of cultivable isolates were analyzed in R (RStudio Team, 2016) with the Fisher-exact test and Bonferroni post hoc correction for multiple testing (α=0.05, significant if p<0.0011).

Global taxonomic distribution of cultivable bacteria

16S rRNA gene sequences were obtained for 388 bacterial isolates and they were distributed among four phyla, 15 bacterial orders, 34 genera, and 46 taxonomically unique strains. Five genera encompassed more than one distinct strain (i.e. at least one verified mismatch in the 16S rRNA sequence): Limnobacter sp. (2), Moraxella sp. (2), Sphingomonas sp. (3), Bacillus sp. (8) and Roseovarius sp. (2). The most abundant phylum among the cultivable isolates was Proteobacteria, with 89% of all isolates and 26 unique strains belonging to this group. Within Proteobacteria, Alpha- and Betaproteobacteria accounted for 34% and 32% of the isolates, respectively. However, Betaproteobacteria comprised three unique strains, while Alphaproteobacteria comprised 16 unique strains in our experiments. 23% of proteobacterial isolates belonged to Gammaproteobacteria, covering seven unique strains. Bacteroidetes (4% of isolates), Firmicutes (4%), and Actinobacteria (3%) were cultivated less frequently compared to Proteobacteria. Despite their lower abundance, the three groups contribute considerably to the cultivable diversity, accounting for 20 out of 46 unique strains. The most abundant cultivable bacterial genera were Limnobacter (27% of all isolates), Halomonas (20%), and Bosea (9%). 80% of Limnobacter isolates were obtained from dilution-to-extinction cultivation experiments. Halomonas strains were predominantly cultivated using direct plating techniques and algae with full flora (84% of Halomonas isolates). For Bosea, most isolates (83%) originated from antibiotic-treated algae. An overview of all bacterial isolates characterized and their corresponding sequence abundances can be found in Figure 1-2 and Supplementary table 1-3.

Direct plating of ground algae and algal protoplast extract (DP)

Direct plating of ground algal tissue and protoplast digest resulted in the isolation and characterization of 110 isolates corresponding to 17 strains of which seven were uniquely isolated with this method. The most frequently isolated strain was Halomonas sp., a gammaproteobacterium that makes up for 58% of isolates obtained with this method. Isolates  of this strain originated predominantly from ground algal tissue rather than algal growth medium (p = 1.92E-13). After Halomonas, Sphingopyxis (10%) and Hyphomonas (8%) were the most frequently isolated taxa. Four isolates originated from protoplast extracts: Imperialibacter sp. (two isolates), Sphingomonas sp. (one isolate) and Plantibacter sp. (one isolate). Direct plating of algal tissue was repeated after three years and Halomonas sp. was again the most frequently isolated strain (nine out of 12 isolates). Sphingomonas 2, and Plantibacter sp. were two protoplast-specific strains obtained using DP, but they were only isolated once in the experiment.

READ  Current State of Small Systems in Virginia

Dilution-to-extinction cultivation (DTE)

One hundred and fifty isolates were identified and 16S rRNA gene sequences revealed eight unique strains. There were no isolates that were specific for the origin of the starting material used (protoplast extract or spent algal growth medium). The most abundant isolates belonged to the genus Limnobacter (55% of isolates), suggesting that they were the most abundant cultivable bacterium in the original algal cultures. Furthermore, five unique strains (Brevundimonas, Erythrobacter, Hoeflea, Ahrensia, and Roseovarius 1) were exclusively found with dilution-to-extinction cultivation. Brevundimonas sp. was significantly more isolated from algal growth media (p  0.00045) compared to algal tissue/protoplast extract (). In addition, some Hyphomonas sp. and Undibacterium sp. strains were isolated but they were not exclusive for this method. Experiments were performed twice in a 6-month interval (DTE1 and DTE2), and Limnobacter was, in both experiments, the most frequently isolated taxon. The ratio of cultivable to total bacteria (estimated culturability) in the experiment varied from 44 to 68%, with different culturability dependent on the type of bacterial growth medium applied. DTE statistics and the Poisson calculations can be found in Table 1-1.

Estimating the proportion of cultivable bacteria in Ectocarpus cultures

16S metabarcoding experiments were carried out with the same algal culture also used for the isolation of bacteria and the libraries were used as a reference for the cultivated and noncultivated microbiome as a whole. After cleaning and filtering of the data, the sequences were clustered into 48 OTUs. The most abundant OTU belonged to the genus Alteromonas (OTU1) and accounted for 41.6% of the reads, which makes Gammaproteobacteria the most abundant class (42.3%). Other abundant OTUs corresponded to an unclassified Rhodobacteraceae (OTU3, 11%) and an unclassified Bacteroidetes (OTU4, 10%). Together these three OTUs correspond to 62% of all sequences (Figure 1-3A). Alphaproteobacteria make up 32.8% of the sequences and Bacteroidetes 15.3% (Figure 1-3B). Other phyla identified are Actinobacteria (2.1%) and Deltaproteobacteria (7.5%). Of the 48 OTUs, 10 corresponded to strains cultivated in our experiments. These 10 OTUs accounted for 47% of the reads in the metabarcoding data. Purely based on absence/presence of OTUs the culturability was 21%. Three additional cultivable strains corresponded to OTUs with sequence abundance below the threshold (n≤5, Staphylococcus, Hyphomonas, Oceanicaulis; Figure 1-3). Furthermore, taking into account all 16S rRNA gene libraries and rare reads, 22 of the 46 cultivable strains were detected. Among the 24 undetected strains that were not found in any of the barcoding libraries, 11 were isolated exclusively from DNSW and 8 exclusively from NSW. In the same vein, 11 strains were cultured exclusively from algal medium, and 7 only from algal tissue (Supplementary table 1- 4).

Cultivable bacteria not detected by metabarcoding

Of the 46 unique strains that were isolated in this study, 16 were isolated at least once from algal tissue grown in NSW, and could thus be directly compared to META2016-NSW metabarcoding data set generated in this study. Seven of them (44%) were represented in this gene library. To be able to compare also strains isolated only from low salinities with metabarcoding data, we included two further data sets obtained for the same strain in 2013. All data sets taken together, 22 of the 46 (48%) strains were found at least in one of the libraries, while 24 were undetectable or below the detection limit. Whether a strain was isolated directly from algal tissue or from the algal culture medium did not have a strong impact on these numbers (Supplementary table 1-4).

Table of contents :

ACKNOWLEDGMENTS
TABLE OF CONTENTS
GLOSSARY
GENERAL INTRODUCTION
HOLOBIONTS IN MULTICELLULAR EUKARYOTES – CHALLENGES & KEY QUESTIONS
HOLOBIONTS IN TERRESTRIAL MODELS
HOLOBIONTS IN BROWN MACROALGAE – A UNIQUE GROUP OF MULTICELLULAR EUKARYOTES
FACTORS THAT SHAPE THE ALGAL HOLOBIONT
MACROALGAL HOLOBIONTS IN A CHANGING ENVIRONMENT
THESIS SUBJECT: THE RESPONSE OF ECTOCARPUS HOLOBIONTS TO CHANGING SALINITY
CHAPTER 1. EXPLORING THE CULTIVABLE ECTOCARPUS MICROBIOME
ABSTRACT
INTRODUCTION
MATERIAL AND METHODS
RESULTS
DISCUSSION
CONFLICT OF INTEREST
AUTHOR CONTRIBUTIONS
FUNDING
ACKNOWLEDGMENTS
CHAPTER 2. CULTIVABLE BACTERIA FROM THE ECTOCARPUS SURFACE – APPLICATIONS
INTRODUCTION
I. THE IMPACT OF CULTIVABLE BACTERIAL SYMBIONTS ON THE FRESHWATER RESPONSE IN ECTOCARPUS SUBULATUS
FRESHWATER STRAIN
II. SPECIFICITY OF CROSS-LINEAGE CROSS-TALK: DO ECTOCARPUS-DERIVED BACTERIA INTERACT WITH ULVA GAMETES?
III. METABOLIC COMPLEMENTARITY BETWEEN ECTOCARPUS AND ASSOCIATED CULTIVABLE BACTERIA: EXPERIMENTAL
VERIFICATION OF IN SILICO PREDICTED BENEFICIAL COMMUNITIES
CHAPTER 3. OMICS APPROACHES TO EXPLORE THE ROLE OF THE ECTOCARPUS MICROBIOME DURING
ACCLIMATION TO FRESH WATER
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FINAL CONCLUSIONS & PERSPECTIVES
BIBLIOGRAPHY
ANNEX 1 SUPPLEMENTARY DATA
SUPPLEMENTARY DATA CHAPTER 1
SUPPLEMENTARY DATA CHAPTER 2
SUPPLEMENTARY DATA CHAPTER 3
ANNEX 2 THE VISUALIZATION AND LOCALIZATION OF BACTERIA ON THE SURFACE OF ECTOCARPUS
SUBULATUS FWS USING FISH AND SEM TECHNIQUES.
INTRODUCTION
ANNEX 3 THE GENOME OF ECTOCARPUS SUBULATUS HIGHLIGHTS UNIQUE MECHANISMS FOR STRESS
TOLERANCE IN BROWN ALGAE
ANNEX 4 ATTENDED CONFERENCES & MEETINGS
ANNEX 5 ATTENDED COURSES
LIST OF FIGURES
LIST OF TABLES

GET THE COMPLETE PROJECT

Related Posts