Project Topics
Get Complete Project Material File(s) Now! »
Soil quality improvement
The goal of agriculturist is obtaining the good production which depends on quality of soil. Soil properties are important determinant for plant growth, crop productivity and sustainable agriculture (Warkentin, 1995). Several soil managements are created to maintain and improve soil health in all physical, chemical and biological properties. Additional, organic matters in the soil are the most important for soil quality improvement because organic carbon and nitrogen are the main source for plants and soil organisms. Furthermore, organic input can provide the short-term productivity and simultaneously, building long-term soil quality. For commercial cropping system in Thailand, there are two main agricultural practices to improve soil efficiency namely organic amendments and cover cropping.
Organic amendments are addition of organic matter sources into soil for modifying soil properties. Sources of organic materials include compost, crop residues, animal manure and green manure. Soil organic matter levels strongly affect soil physical, chemical and biological processes. The final product of organic matter decomposition is humus (or stable soil organic matter) which has benefit on soil physical properties. Soil organic matter levels can improve soil structure including aggregate stability, water infiltration and water holding capacity (Franzluebbers, 2002; Loveland and Webb, 2003; Lado et al., 2004; Gajic et al., 2006). The increasing ability of soil infiltration and permeability can also reduce excess salinity accumulation in soil (Miller et al., 2005). Organic matter contributes to soil fertility because its decomposition processes have released available nutrients for plant growth such as nitrogen, phosphorus and potassium (Blair and Boland, 1978; Pinamonti, 1998; Ingram et al., 2005; Lupwayi et al., 2007; Mukuralinda et al., 2009). In addition, organic matter can increase cation exchange capacity (CEC). This effect contribute to soil chemical stabilization by binding humic acid-mineral nutrients (Oorts et al., 2003; Kaiser et al., 2008). Furthermore, soil organic matter contents also enhance soil microbial community. Increasing microbial activities contribute to soil structure and directly affect soil fertility (Wander et al., 1994; Nelson and Mele, 2006; Fliessbach et al., 2007; Hamer et al., 2008). Additionally, quality of organic materials strongly influence soil macrofaunal, the activity of macrofaunas enhance soil physical properties such as soil hydraulic capacity. Increasing macrofaunal biomass and diversity can contribute to soil microbial activity (Lal, 1988b; Mando, 1997; Mboukou-Kimbatsa et al., 1998; Frouz et al., 2006b; Frouz, 2008). Furthermore, organic matter can reduce soil polluted chemicals because humic acid can absorb chemical pollutants such as pesticides and herbicides (Senesi et al., 1995; Beyer and Blume, 1996; Cells et al., 1997).
Cover cropping or green manuring is agricultural practice by growing beneficial plants that can improve soil quality in agroecosystem. Several cover crops including grasses, small grains and legumes are useful to improve soil physical, chemical and biological properties. The leguminous plants are commonly used as cover crop to improve soil fertility because they can provide nitrogen into soil by nitrogen fixation process which arises from rhizobial bacteria (Frioni et al., 1998). Some cover crop species were efficient in recycling nutrients (Rosolem et al., 2002; da Silva and Rosolem, 2003; Franchini et al., 2004). When cover crops are plowed down or terminated, they release nutrients by mechanisms of decomposition and this also increase soil fertility. Because cover cropping is adding energy sources of living soil organisms, diversity and abundance of soil organisms are enhanced. Increasing activity of soil organisms positively influence soil quality (Boyer et al., 1999; Cederbaum et al., 2004; Ingels et al., 2005; Blanchart et al., 2006; Dinesh et al., 2009). Furthermore, increasing organic matter levels by cover crop residues can improve soil physical properties such as soil structure, and water and nutrient holding capacity (Patrick et al., 1957; Robertson et al., 1991; Arevalo et al., 1998; Muñoz-Carpena et al., 2008). In addition, cover crop can protect damaging soil productivity by reducing or preventing soil surface from erosion (Greene et al., 1994; Martinez-Raya et al., 2006; Zuazo et al., 2006; Zuazo and Pleguezuelo, 2008). The networks of cover crop roots are the suitable habitat for soil macrofaunas and also increase soil porosity (Carof et al., 2007). Increasing soil porosity involves water infiltration and soil water storage (Joyce et al., 2002). Cover crops can protect soil water evaporation and increase soil moisture (Hopkinson, 1971), this is important for activity of soil organisms. Additionally, cover crop can protect desired plant from pests and weeds. The growth of weeds and the germination of weed seeds are suppressed by thick cover crops (Bradshaw and Lanini, 1995; Linares et al., 2008). Some cover crops have ability in destroying plant pests (know as trap crops) or attracting beneficial insects and predators of plant pests, these plant species can be used as biological control of plant pests (Bugg and Waddington, 1994; Rea et al., 2002; Shelton and Badenes-Perez, 2006; Youn and Jung, 2008). Several cover crops can destroy plant disease cycle or reduce population of plant pathogens, and release toxic chemicals affecting phytopathogens in soil including bacteria, fungi and nematode (Crow et al., 2001; Hartz et al., 2005; Blanchart et al., 2006; Timper et al., 2006). Furthermore, cover crops can increase biomass of beneficial invertebrates and microorganisms in soil, which theirs activities can also reduce soil borne pathogens (Boyer et al., 1999; Abawi and Widmer, 2000).
Importance of soil microorganisms
Soil microorganisms are greatly important in soil food web and natural equilibrium. Microorganisms in soil are significantly relative to healthy soil and healthy plant because they are a considerable component of soil physical and chemical processes. The soil microbial communities can improve soil structure for plant growth by enhancing soil aggregate stability. Bacterial polysaccharides and, fungal hypha and metabolic products play important role in binding soil particles together (Robertson et al., 1991; Hu et al., 1995; de Caire et al., 1997; Caesar-TonThat and Cochran, 2000). Soil aggregation is necessary for soil quality to improve infiltration rate, water holding capacity and plant root development. Thus, decreasing microbial biomass and theirs activities are a result in reducing soil aggregation (Neves et al., 2003; An et al., 2009). Numerous species of microorganisms including protozoa, bacteria, fungi and nematode are contained in soil. However, bacteria and fungi seem to be the most important in soil nutrient cycling because they are the first organisms degrading organic materials as theirs energy source. Soil fertility is enhanced by increasing microbial biomass. Soil microbes strongly influence soil biogeochemical because they obviously express their ability in organic matter decomposition, nutrient mineralization and nutrient cycling (Barbhuiya et al., 2004; Ingram et al., 2005; Devi and Yadava, 2006; Faterrigo et al., 2006; Fosu et al., 2007; Lucas et al., 2007). Furthermore, some soil microorganisms have potential to degrade or detoxify chemical pollutants and pesticides in soil (Reed et al., 1989; Rhine et al., 2003; Trabue et al., 2006; Zhang et al., 2008). However, structure of microbial community depend on many factors such as climate, moisture, topography, plant growth, and quantity and quality of substrates (Schinner, 1982; Alvarez et al., 1995; Smith and Goodman, 1999; Norris et al., 2002; Barbhuiya et al., 2004; Tilak et al., 2005; Devi and Yadava, 2006; Waldrop et al., 2006). Additionally, soil chemical (e.g., pH and salinity) and physical condition (e.g., texture and soil-water potential) are also influence soil microbial efficiency (Zhang and Zak, 1998; Emmerling et al., 2001; Gleeson et al., 2008; Wong et al., 2008; Sawada et al., 2009). Hence, soil microbial community composition structure can respond to environmental change and it has been used for monitoring impact of agricultural practices and ecological stresses on soil health (Steenwerth et al., 2002; Potthoff et al., 2006).
Analysis of soil microbial community structure
The reservoir of soil microorganisms is the pore structure within and between soil particles. The community of soil microorganisms can use as useful indicator of soil quality and ecological stresses because of theirs adaptation. Because soil microbes are greatly important in agroecosystem, the microbial community structure assessment with accurate and reliable methodology is necessary. The methods for studying soil microbial diversity can be categorized into two major groups: biochemical-based and molecular-based methods (Kirk et al., 2004).
Plate count is one of common methods that used for analyzing soil bacterial and fungal diversity. This method is a biochemical-based method to enumerate the viable soil microorganisms. The viable count has benefit to provide information on the active, heterotrophic component of population. This method has been used to evaluate the response of soil microorganisms to polluted soil (Thompson et al., 1998; Piotrowska-Seget et al., 2005; Oliveira and Pampulha, 2006) and agricultural practices (Buyer and Kaufman, 1997; Willison et al., 1997; Leckie et al., 2004; Zablotowicz et al., 2007; Zheng et al., 2007). However, many bacterial and fungal species in soil cannot be cultured in the present methods under laboratory condition (Torsvik et al., 1990; Torsvik et al., 1998; van Elsas et al., 2000). The molecular-based methods have been developed to study microbial diversity in natural environments because these methods can detect non-culturable microorganisms. The denaturing gradient gel electrophoresis (DGGE) which is one of PCR-based approaches is mostly used to evaluate microbial community of environmental sample. Because the PCR products of environmental sample consisting the similar DNA sizes cannot be separated by conventional separation using agarose gel electrophoresis, these DNA can separate and migrate through a polyacrylamide gel by DGGE technique. Furthermore, the DGGE can rapidly analyze the large number of samples and is also reliable and reproducible (Lerner et al., 2006; Nakatsu, 2007; Liang et al., 2008). This approach has been diversely used to analyzed soil microbial community such as impact of perturbed agricultural soil (Jensen et al., 1998; Øvreås et al., 1998), agricultural practices (Nakatsu et al., 2000; Vepsäläinen et al., 2004; Stark et al., 2007), fumigants (Ibekwe et al., 2001), land usage (Bossio et al., 2005), thermal gradient (Norris et al., 2002) and plant root exudation (Yang and Crowley, 2000) on soil microbial diversity. However, the accuracy of microbial community investigation can be increased by using a combination of culture-dependent and culture-independent methods (Ellis et al., 2003; Edenborn and Sexstone, 2007; Fang et al., 2007). Furthermore, using soil microbial community structure combining soil enzyme activity are usually used to assess impact of soil environment change on soil health arising from polluted chemical (Akmal et al., 2005; Martínez-Iñigo et al., 2009) and soil managements (Sun et al., 2004; Stark et al., 2007; Stark et al., 2008) because large numbers of soil samples are rapidly investigated and it reveal the real impact.
Enzyme activity in soil
All biochemical transformations in soil are related to the presence of enzymes which are produced by microorganisms (de Caire et al., 2000; Stark et al., 2008), soil animals and plants (Gramss et al., 1999). Nevertheless, the most of enzymes in soil are originated from microbes because they have larger biomass, higher metabolic activity and larger amount of extracellular than plants and animals. Enzymatic mechanism contributes to soil health, which is important for plant productivity. Soil enzymes are the great importance for agriculture because they are involved in soil fertility (Dick et al., 1988; Bandick and Dick, 1999; Hu and Cao, 2007). Organic materials are degraded and transformed into available forms by mechanism of soil enzyme. Soil enzymes play specific role in soil cycling of nutrients such as nitrogen, carbon, phosphorus and sulphur (Gianfreda et al., 2005; Acosta-Martínez et al., 2007; Chen et al., 2008; Sardans et al., 2008). The evaluation of integrative activity of several soil enzymes is greatly efficient to predict the quality of soil because soil enzyme activity is closely related to soil physical and chemical properties, and soil microbial community (Decker et al., 1999; Andersson et al., 2004; Roldán et al., 2005; Acosta-Martínez et al., 2007; Iovieno et al., 2009). Furthermore, some toxic chemicals including pesticides and heavy metals are degraded or detoxified by soil enzyme (Gibson and Burns, 1977; Burns and Edwards, 1979; Niemi et al., 2009). However, the activity of enzyme depends on soil texture, temperature, pH, moisture, heavy-metal contamination, quality and quantity of substrates (Sinsabaugh and Linkins, 1987; Virzo De Santo et al., 1993; Rutigliano et al., 1996; Fioretto et al., 2000; Kourtev et al., 2002; Hinojosa et al., 2004; Sardans and Peñuelas, 2005; Acosta-Martínez et al., 2007).
Soil fungal enumeration and isolation
Enumeration of soil fungi were conducted according to a method adapted from Diouf et al. (2005) using plating dilution method. Soil (5g) was agitated in 50 ml of dispersing solution for 30 min and allowing soil precipitation for 15 min. The fungal suspensions were decimal diluted in physiological solution (9g/1 of Nacl). Each of fungal dilution with 200 µl was cultured in Sabouraud medium (added 0.005% w/v of Chloramphemicol – Si gma). The assay was performed in triplicate. The numbers of fungal colonies were determined after incubation at 27 °C for 5 days. The differential colony morphotypes were isolated and purified on Sabouraud medium. The mycelia of selected fungi were conserved at -20 °C for molecular identification.
Identification of culturable fungi
The selected fungi were identified the taxonomic position by using molecular biology technique. DNA was extracted from mycelium according to Di Battista method (Di Battista, 1997). The nucleotide fragment of 650 bp (ITS1-5.8S-ITS2 region) was amplified by PCR technique using primer set ITS1 (5’TCCGTAGGTGAACCTGCGG 3’) and ITS4 (5’ TCCTCCGCTTATTGATATGC 3’) (White et al., 1990). PCR amplification was performed using Ready-To-Go Taq poloymerease (Pharmacia). The condition of PCR cycles were initial denaturation at 94 °C for 5 min, 29 cycles of 94 °C for 45s, 60 °C for 45s, 72 °C f or 1 min and final elongation step at 72 °C for 30s. PCR amplification was perf ormed with a thermal cycle (GenAmp PCR System 2400; Perkin-Elmer). All PCR products were investigated using 5 µl of product by electrophoresis in 2% (w/v) agarose gel in 0.5X TAE buffer (Biorad) and ethidium bromide (0.5 µg/ml) staining. DNA sequencing was performed by Genome Express (Grenoble, France). The DNA sequences were compared with other DNA sequences using GenBank BLAST searches.
Genetic diversity of soil fungi
Fungal DNA was extracted from soil samples as described by Porteus (Porteous et al., 1997). The DNA region of 28S rDNA was amplified using primer set 403f (5’ GTGAAATTGTTGAAAGGGAA 3’) and 662r (5’ GACTCCTTGGTCCGTGTT 3’ ) with 40 bases GC clamp (Sigler and Turcob, 2002). PCR amplification was performed using Ready-To-Go Taq poloymerease (Pharmacia). Cycling condition were initial denaturation at 94 °C for 5 min, 35 cycles of 94 °C for 30s, 50 °C for 1 min, 72 °C for 2 min and f inal elongation step at 72 °C for 10 min. PCR amplification was performed with a thermal cycle (GenAmp PCR System 2400; Perkin-Elmer). The PCR products were investigated as described above and PCR amplicons were determined for different position by DGGE (Denaturing Gradient Gel Electrophoresis) using DcodeTM Universal Mutation Detection System (Biorad, Richmond, CA). For DGGE, 20 µl of product was loaded onto 8% (w/v) polyacrelamide gel containing linear gradient of the denaturants urea and formamide increasing from 35%-60% (100% denaturant contains 7 M urea and 40% (v/v) formaminde). Gel electrophoresis was carried out at initial 20 V for 10 min then 75 V for 16 h. Gels were run in 0.5X TAE at constant temperature of 60 °C. Gels were stained in an ethidium bromi de solution and photographed under UV transillumination using GelDoc 2000 system (Biorad).
Table of contents :
ABSTRACT
THESIS OUTLINE AND OBJECTIVE
I – REVIEW PART
I.1 Hevea brasiliensis and trunk phloem necrosis
I.1.1 H. brasiliensis as economically important tree
I.1.2 Trunk phloem necrosis disease
I.2 Soil quality
I.2.1 Soil quality components
I.2.2 Soil quality improvement
I.3 The role of soil macrofauna
I.4. Soil microorganisms
I.4.1. Importance of soil microorganisms
I.4.2. Analysis of soil microbial community structure
I.5. Enzyme activity in soil
I.6 Soil ecological stress
II. MATERIALS AND METHODS
II.1 Experimental site description
II.2 Macrofauna sampling
II.3 Soil sampling and preparation
II.4 Soil analysis
II.5 Soil enzyme activity
II.6 Soil fungal community
III.6.1 Soil fungal enumeration and isolation
III.6.2 Identification of culturable fungi
III.6.3 Genetic diversity of soil fungi
II.7 Analysis of plant growth
II.8 Statistical analysis
III – RESULTS
CHAPTER III.1 TPN AND SOIL ENVIRONMENT
Abstract
III.1.1 INTRODUCTION
III.1.2 EXPERIMENTAL DESIGN
III.1.3 RELATIONSHIP BETWEEN TPN ANDDIFFERENT SOIL PROPERTIES
III.1.4 TPN AND SOIL MACOFAUNA
III.1.4.1 Macrofauna density
III.1.4.2 Macrofauna diversity
III.1.5 TPN AND SOIL ENZYME ACTIVITY
III.1.5.1 Rainy season
III.1.5.2 Dry season
III.1.6 TPN AND FUNGAL COMMUNITY
III.1.7 DISCUSSION
III.1.7.1 TPN and soil properties
III.1.7.2 Impact of trunk phloem necrosis on macrofauna community
III.1.7.3 Relationship between trunk phloem necrosis and soil enzyme activity
III.1.7.4 The influence of trunk phloem necrosis on soil microbial community
III.1.8 CONCLUSION
CHAPTER III.2 IMPACT OF SOIL ORGANIC AMENDMENTS ON SOIL BIOLOGICAL ACTIVITIES
Abstract
III.2.1 INTRODUCTION
III.2.2 EXPERIMENTAL DESIGN
III.2.3 IMPACT OF SOIL AMENDMENTS ON PLANT GROWTH
III.2.4 IMPACT OF SOIL ORGANIC AMENDMENTS ON SOIL PROPERTIES
III.2.5 IMPACT OF SOIL ORGANIC AMENDMENTS ON MACROFAUNA COMMUNITY
III.2.5.1 Macrofauna density
III.2.5.2 Macrofauna diversity
III.2.6 IMPACT OF SOIL ORGANIC AMENDMENTS ON SOIL ENZYME
III.2.7 DISCUSSION
III.2.7.1 Soil quality and plant productivity
III.2.7.2 Impact of soil amendment on macrofauna community
III.2.7.3 Impact of soil organic amendment on soil enzyme activities
III.2.8 CONCLUSION
GENERAL CONCLUSION AND FUTURE PERSPECTIVES
REFERENCES
