Chicken Digestive and Small Intestine Micro Anatomy

Get Complete Project Material File(s) Now!

CHAPTER IV.MATERIALS AND METHODS

Animals

Pooled semen was used to inseminate females from the 48th generation of LWS and HWS to obtain HH (HWS X HWS) and LL (LWS X LWS) and their reciprocal crosses, LH (LWS males crossed with HWS females) and HL (HWS males crossed with LWS females). Eggs from the four mating combinations (MC) were incubated for 21 days. On day of hatch (DOH, without access to feed and water) chicks were wing banded for identification and placed in battery cages with 10-15 chicks per cage. Chicks had ad libitum access to a corn/soy mash diet that contained 20% crude protein and 2,685 kcal ME/kg. For complete diet formulation see Tables 1, 2, and 3. The LL and HL chicks were also offered feed on paper in addition to feeders for 7 days to enhance chick survival

Tissue Sampling

All chicks were sampled on embryonic day 20 (E20), DOH, and days 3 (D3), 7 (D7), and 14 (D14) post hatch. On E20 12-16 eggs per MC were weighed and broken open. A portion of the liver was rinsed in ice cold phosphate buffered saline (1.47 mM NaH2PO4, 8.09 mM Na2HPO4, 145 mM NaCl) and frozen on dry ice. The small intestine was separated into duodenum (portion extending from the gizzard to end of duodenal loop), jejunum (portion from the end of the duodenal loop to Meckel’s diverticulum), and ileum (portion from Meckel’s diverticulum to the ileal-cecal junction). All segments were then rinsed in ice cold PBS and minced. One 20-30 mg tissue aliquot was placed in a 2-mL microfuge tube and frozen on dry ice, while the remaining tissue  was divided into ≤ 1 g aliquots and flash frozen in liquid nitrogen. All samples were stored at -80°C. On post hatch sampling days all chicks were weighed. Chicks sampled were killed by cervical dislocation and the liver and small intestine were subsequently collected using the same method employed for E20

Chick Sexing by PCR

DNA was extracted from liver samples using the DNeasy kit according to the animal tissue protocol (Qiagen, Valencia, CA). DNA was quantified spectrophotometrically at OD 260 (U-2000, Hitachi North America). DNA was diluted to 0.05 µg/ µL in TE buffer (10 mM Tris HCl, pH 7.5; 1 mM EDTA). The following 20 µL PCR reaction was set up: 12.7 µL sterile ultra-pure water, 2.0 µL 10X PCR Buffer B (Fisher Scientific, Pittsburgh, PA), 1.2 µL 25 mM MgCl2 (Fisher Scientific), 0.4 µL 10 mM each dNTP’s, 0.4 µL each of 5 uM primers for a “W” chromosome specific gene (forward: 5’ CTGTGATAGAGACCGCTGTGC 3’, reverse: 5’ CAACGCTGACACTTCCGATGT 3’) (MWG, Charlotte, NC), 0.4 µL each of 5 µM primers for a 376 bp amplicon of the PepT1 gene (forward: 5’ TTGTCTCCCTGTCCATTGTCTATAC 3’, reverse: 5’ GTTCTTCAAACTGATCCCCACCAAA 3’) (MWG), 0.1 µL of Taq DNA polymerase, 5 units/ µL (Fisher Scientific), and 2.0 microliters of 0.05 µg/µL DNA. A PTC-200 Peltier thermocycler (MJ Research, Waltham, MA) was used to carry out the PCR reaction: 2 min at 94 °C followed by 35 cycles of denaturing (30 s at 94 °C), annealing (1 min at 55 ºC), extension (1 min at 72 °C), and ending with a 7 min extension at 72 ºC.Following PCR, 10 µL of the PCR product and 10 µL of loading dye (0.2% bromophenol blue, (Sigma-Aldrich, St. Louis, MO), 0.2% xylene cyanole (SigmaAldrich) 80% glycerol (Sigma-Aldrich)) were mixed and run along with DNA standards (DNA Hi-Lo ladder; Fisher Scientific) on a 1% (w/v) agarose gel. Females were identified by the presence of two bands: a 376 bp amplicon of PepT1 and a 1200bp amplicon of the “W” chromosome, while males were identified by the presence of one band corresponding to the 376 bp amplicon of PepT1

READ  WHY MAGNESIUM IN ALUMINUM-SILICON ALLOYS

TITLE PAGE 
ABSTRACT
ACKNOWLEDGEMENTS 
TABLE OF CONTENTS
LIST OF FIGURES 
LIST OF TABLES 
CHAPTER I. INTRODUCTION 
CHAPTER II. REVIEW OF LITERATURE 
White Plymouth Rock Chickens Divergently Selected for High or Low
Juvenile Body Weight
Introduction 
The Development of the Selected Lines and Response in Eight-Week Body Weight 
Correlated Responses to Selection in Growth and
Development Related Traits
Correlated Responses to Selection in Metabolic
Related Traits
Summary
Chicken Digestive and Small Intestine Micro Anatomy 
Upper Gastrointestinal Anatomy 
Lower Gastrointestinal Anatomy 
Small Intestine Microanatomy
Summary
Carbohydrate Digestion in the Chicken and the Brush Border Membrane
Glucose and Fructose Transporters
Introduction
Carbohydrate Digestion in the Chicken 
The Intestinal Sodium-Dependent Glucose Transporter, SGLT1
Introduction
Tissue and Cellular Distribution of SGLT1
Substrates of SGLT1
Structure of SGLT1
Transport Mechanism of SGLT1
Regulation of SGLT1
Summary
The Intestinal Facilitated Fructose Transporter, GLUT5 
Introduction
Tissue and Cellular Distribution of GLUT5
Substrates of GLUT5
Structure of GLUT5
Transport Mechanism of GLUT5
Regulation of GLUT5
Summary
Protein Digestion in the Chicken and the Brush Border Membrane
Peptide and Glutamate/Aspartate Transporters 
Introduction
Protein Digestion in the Chicken
The Intestinal Oligopeptide Transporter, PepT1
Introduction
Tissue and Cellular Distribution of PepT1
Substrates of PepT1
Structure of PepT1
Transport Mechanism of PepT1
Regulation of PepT1
Summary
The Intestinal Glutamate/Aspartate Transporter, EAAT3
Introduction
Tissue and Cellular Distribution of EAAT3
Substrates of EAAT3
Structure of EAAT3
Transport Mechanism of EAAT3
Regulation of EAAT3
Summary
CHAPTER III. OBJECTIVES
CHAPTER IV. MATERIAL AND METHODS
Animals
Tissue Sampling
Chick Sexing by PCR
Total RNA Extraction
Reverse Transcription
Quantitative Real-Time PCR
Quantitative Real-Time PCR Analysis
Statistical Analysis
CHAPTER V. SEXUAL DIMORPHISM IN THE DEVELOPMENTAL GENE EXPRESSION OF NUTRIENT TRANSPORTERS IN THE SMALL INTESTINE
OF CHICKENS FROM LINES DIVERGENTLY SELECTED FOR HIGH OR LOW JUVENILLE BODY WEIGHT 
Results 
Egg and Body Weight
Gene Expression of PepT1
Gene Expression of EAAT3
Gene Expression of SGLT1
Discussion
CHAPTER VI. DEVELOPMENTAL GENE EXPRESSION OF NUTRIENT TRANSPORTERS IN THE SMALL INTESTINE OF MALE CHICKENS FROM LINES DIVERGENTLY SELECTED FOR HIGH OR LOW BODY WEIGHT AND THEIR RECIPROCAL CROSSES
Results 
Egg and Body Weight
Gene Expression of PepT1
Gene Expression of EAAT3
Gene Expression of SGLT1
Gene Expression of GLUT5
Mating Combination Effect in the Ileum
Discussion
CHAPTER VII. EPILOGUE
LITERATURE CITED 
VITA

GET THE COMPLETE PROJECT

Related Posts