Project topics and materials
Get Complete Project Material File(s) Now! »
qPCR evaluation of copy number across repetitive element targeting gRNAs –
The qPCR reactions were generated using the KAPA SYBR FAST Universal 2X qPCR Master Mix (Catalog #KK4602) according to the manufacturer’s instructions. The LightCycler 96 machine from Roche was used to perform the qPCRs and the results were extracted using the LightCycler 96 SW 1.1 software. The following thermocycling conditions were used: « preincubation » stage = 95°C for 180 sec; « 2-step cycling »
stage: annealing = 95°C for 3 sec and elongation = 60°C for 20 sec; « Melting » stage was kept standard.
The following primers were used to perform the qPCRs.
SpCas9 and gRNA plasmids used for genome editing
The following Cas9 plasmids were used: pCas9_GFP (Addgene #44719), hCas9 (Addgene #41815). Base editing plasmids used: pCMV_BE3 (Addgene #73021), pCMV_BE4 (Addgene #100802), pCMV_BE4-gam (Addgene #100806), ABE 7.10 (Addgene #102909). The gRNAs used in this study were synthesized and cloned as previously described142. Briefly, two 24mer oligos with sticky ends compatible for ligation were synthesized from IDT for cloning into the pSB700 plasmid (Addgene Plasmid #64046).
SaCas9 and gRNA plasmids used for genome editing
Cas9 plasmid: pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA (Addgene #61592). Base editing plasmid: SaBE4-gam (Addgene #100809). The gRNAs used in this study were synthesized and cloned as previously described143. Briefly, two 24mer oligos with sticky ends compatible for ligation were synthesized from IDT for cloning into the BPK2660 plasmid (Addgene Plasmid #70709).
Maintenance and transfection of HEK 293T cells
HEK293T cells were obtained from ATCC with verification of cell line identification and mycoplasma negative results. They were expanded using 10% fetal bovine serum (FBS) in high-glucose DMEM with glutamax passaging at a typical rate of 1:100 and maintained at 37 C with 5% CO2. Transfection was conducted using Lipofectamine 2000 (Thermofisher Catalogue # 11668019) using the protocol recommended by the manufacturer with slight modifications outlined below. 24 hours before transfection ~1.0 x 105 cells were seeded per well in a 12-well plate along with 1 mL of media. A total of 2 g of DNA was transfected using 2 L of Lipofectamine 2000 per well. For Cas9 plasmids, the DNA content per well contained 1 g of pCas9_GFP mixed with 1 g of gRNA-expressing plasmid. For BE plasmids, 1.5 g of BE was mixed with 0.5 g of gRNA plasmid. In the dBE vs nBE comparison, Pifithrin-α (10 ng/ l) from Sigma-Aldrich P4359 (source # 063M4741V, Batch # 0000003019) was added to the media 30 minutes before transfection and maintained in the first day media change.
FACS Single cell direct NGS preparation
To quantify early genetic editing in cells transfected with Cas9/BE and gRNA expression plasmids, single cells were sorted and prepared as follows. Two days post-transfection, single cells were FACS-sorted into 96-well PCR plates containing 10 L of QuickExtract DNA Extraction Solution (Epicentre Cat. # QE09050) per well and genomic DNA (gDNA) was extracted using the manufacturer’s protocol. Briefly, the sorted plates were sealed, vortexed and heated at 65 C for 6 minutes then 98 C for 2 minutes. The NGS library was prepared as described later below.
Single cell clonal isolation and sequence verification
Single cells were FACS-sorted into flat bottom 96-well plates containing 100 L of DMEM with 10% FBS and 1% Penicillin/Streptomycin per well. Sorted plates were incubated for ~14 days until well-characterized grown colonies were visible, with periodic media changes performed as necessary. To extract gDNA, the cells were first detached using 30 L TrypLE Express (Thermofisher Cat. # 12604021), neutralized with 30 L growth media, and then 4 L of the resulting cell suspension was transferred to 10 L of QE. Genomic DNA was extracted according to manufacturer’s protocol, as described previously.
Nested PCR Illumina MiSeq library preparation and sequencing
Library preparation was conducted as previously described144. Briefly, genomic DNA was amplified using locus-specific primers attached to part of the Illumina adapter sequence. A second round of PCR included the index sequence and the full Illumina adapter. All PCRs were carried out using KAPA HiFi HotStart ReadyMix (KAPA Biosystems KK2602) according to the manufacturer’s thermocycler conditions. Libraries were purified using gel extraction (Qiagen Cat. # 28706), quantified using Nanodrop and pooled together for deep sequencing on the MiSeq using 150 paired end (PE) reads.
NGS indel analysis
Raw Illumina sequencing data was demultiplexed using bcl2fastq. All paired end reads were aligned to the reference genome using bowtie2145 and the resulting alignment files were parsed for their cigar string to determine the position and size of all indels within each read using a custom perl script. All indels that were sequenced in both forward and reverse reads were summed across all reads and reported for each sample along with total reads. Indels within a 30bp window from the 5’ start of the gRNA proceeding through the PAM and extending an additional seven bp’s (for a 20bp gRNA) were counted and summed for each sample.
Dual gRNA deletion frequency NGS analysis
Reads were analyzed for dual gRNA large deletions by detecting sequences in between the gRNAs to indicate full length unedited (at least not dual gRNA-edited) and sequences beyond the normal wild type amplicon that only appear when the deletion has occurred to identify deletion reads. The custom perl script used for analysis is available (sup. X)
NGS base editing deamination analysis
All paired end reads were aligned to the reference genome using bowtie2, and the resulting alignment files were converted to bam, sorted, indexed, and variant called using samtools146. All SNV data within a 30bp window from the 5’ start of the gRNA proceeding through the PAM and extending an additional seven bp’s (for a 20bp gRNA) is reported to analyze the editing window and purity of editing. A custom perl script used for analysis.
Automated CRISPR and Base Editing pipeline
Here we describe the steps followed in the automated CRISPR base editing pipeline. The input consists of a set of reference genomes R, a set of gRNA G, type of editors, E, with their window-specific details, and a set of samples S. The output is the comprehensive analysis of base editing in the window specific to a base editor for all samples. To achieve this, we align gRNA set G and samples S to reference genomes R using bwa. Furthermore, we sort the alignment outputs using Picard. To calculate the window specific to base editor, we consider the starting positions of G and add offsets and window sizes from E. We now precisely look into these specific windows and report the number of reads supporting different alleles. For indel analysis, we compute the reads with indels in these windows and report into the final analysis.
Site directed mutagenesis to remove remaining nick from base editors
We deactivated the remaining nuclease domain of Cas9 from (C)BE4-gam (Addgene #100806), pCMV- ABE7.10 (Addgene #102919), and SaCas9-BE4-gam (Addgene #?). Agilent QuikChange XL Site-Directed Mutagenesis Kit (catalogue # 200517) was used with the following primer sequences:
SaCas9-fwd – ATAACAAAGTTCTGGTTAAACAGGAGGAAGCCTCTAAAAAAGGGAACCGGACC
SaCas9-rev – GGTCCGGTTCCCTTTTTTAGAGGCTTCCTCCTGTTTAACCAGAACTTTGTTAT
Table of contents :
Acknowledgements
Résumé en français
Abbreviations
1. General Introduction
1.1. The central dogma of biology: DNA, RNA and proteins
1.2. CRISPR-Cas9: From bacterial immune system to genome editing tool
1.3. The CRISPR-Cas9 revolution: From single edits to whole-genome recoding
1.4. Experimental strategy and research outline
2. Transposable Elements of the Genome
2.1. Introduction
2.2. LINE-1
2.3. Alu
3. Multiplex Genome Editing Technologies
3.1. Introduction
3.2. The State of Multiplex Genome Editing Technologies
3.2.1. Multiplex Editing in Eukaryotic Genomes
3.2.2. Strategies for Multiplex Guide RNA Expression
3.2.3. Lessons from Bacterial Genome Engineering
3.3. Application of Multiplex Genome Editing
3.3.1. Combinatorial Functional Genomic Methods
3.3.2. Therapeutic Application of Multiplex Editing
3.3.3. Genome Writing
3.3.4. Repetitive Genetic Elements
3.4. Methods of Multiplex Genome Editing
3.4.1. Base Editing
3.4.2. Programmable Recombinases
3.4.3. Large Donor DNAs
3.4.4. Generating Large ssDNA
3.4.5. Programmed Genome Rearrangement
3.4.6. Multiplex Delivery
3.4.7. Delivery of Large DNAs
3.5. Conclusion
4. Developing Large-Scale Genome Editing Technologies
4.1. Introduction
4.2. Methods
4.2.1. Transposable element gRNA design
4.2.2. qPCR evaluation of copy number across repetitive element targeting gRNAs –
4.2.3. SpCas9 and gRNA plasmids used for genome editing
4.2.4. SaCas9 and gRNA plasmids used for genome editing
4.2.5. Maintenance and transfection of HEK 293T cells
4.2.6. FACS Single cell direct NGS preparation
4.2.7. Single cell clonal isolation and sequence verification
4.2.8. Nested PCR Illumina MiSeq library preparation and sequencing
4.2.9. NGS indel analysis
4.2.10. Dual gRNA deletion frequency NGS analysis
4.2.11. NGS base editing deamination analysis
4.2.12. Automated CRISPR and Base Editing pipeline
4.2.13. Site directed mutagenesis to remove remaining nick from base editors
4.2.14. Propidium Iodide and Annexin V staining and FACS analysis
4.2.15. Karyotype analysis of LINE-1 dBE-edited 293T single cell clones
4.2.16. Maintenance and expansion of human iPSCs
4.2.17. Nucleofection in PGP-1 iPSCs
4.2.18. Clonal isolation of PGP-1 iPSCs
4.3. Results
4.3.1. gRNA design and copy number estimation of transposable elements
4.3.2. CRISPR/Cas9 editing at a range of high copy number targeting gRNA does not allow the isolation of stably edited clones
4.3.3. nCBE and nABE activities confirmed at LINE-1
4.3.4. nCBEs enable isolation of stable cell lines with hundreds of edits
4.3.5. Nick-less dBE confirmation at a single locus
4.3.6. Nick-less dBE targeting of LINE-1 in 293T
4.3.7. dABE activity in PGP1 iPSCs
4.4. Discussion
4.5. Supplementary Figures and Tables
5. CRISPR-mediated biocontainment technologies
5.1. Introduction
5.2. Methods
5.2.1. Cas9, sgRNA and anti-CRISPR plasmids used for genome editing
5.2.2. Human iPSCs cell culture
5.2.3. Transfection of human iPSCs
5.2.4. Synthesis and genomic integration of the CRISPR-DS into HEK 293T cells
5.2.5. Propidium Iodide and Annexin V staining and FACS analysis
5.2.6. Antibody staining and fluorescent microscopy
5.2.7. Transfection of HEK 293T
5.2.8. Preparation of HEK 293T samples for Insertions and Deletions (indels) analysis
5.2.9. Insertions and deletions (indels) analysis
5.2.10. Illumina MiSeq library preparation and sequencing
5.2.11. NGS data analysis
5.3. Results
5.3.1. Design of the sgRNAs targeting repetitive elements
5.3.2. CRISPR Defense System prevents the formation of populations harboring DNA edits
5.3.3. CRISPR-Cas9 targeting high-copy number loci rapidly causes DNA damage
5.3.4. CRISPR-DS compared to systems targeting essential genes or using anti-CRISPR proteins
5.3.5. Towards the development of a safety switch for cell therapies based on the Cas9- targeting of repetitive elements
5.4. Discussion
5.5. Supplementary figures
6. Ethical and regulatory considerations of genome editing
7. Research overview & perspectives
7.1. Multiplexed genome editing: today’s limits and tomorrow’s promises
7.2. Large-scale genome editing at repetitive elements
7.3. CRISPR-mediated bio-containment technologies
List of figures and tables
Bibliography
